Child pages
  • Long PCR Method
Skip to end of metadata
Go to start of metadata

Long PCR method for amplifying and sequencing full mitochondrial DNA from Daphnia pulex

Contributed by Susanne Paland

Table of content:

  • PCR thermal cycling program
  • Polymerase
  • PCR mix (50 µl total volume)
  • PCR amplification primers** 6Long PCR primers (5' - 3')
  • Estimated product sizes for Long PCR primer combinations
  • Primer-walking strategy
  • Primer-walk sequencing primers (5' - 3')
  • Other mitochondrial PCR/sequencing primers (5' - 3')

PCR thermal cycling program

Step

Temperature

Time

1

94 Cº

0:03:00

2

94 Cº

0:00:10

3

68 Cº

0:03:00

4

Repeat steps 2-3, 15 times

5

94 Cº

0:00:10

6

68 Cº

0:03:20 + 20 sec. per subsequent cycle

7

Repeat steps 5-6, 15 times

8

4 Cº

hold


Polymerase

Extensor Hi-Fidelity PCR Enzyme Mix

http://www.adbio.co.uk/downloads/ab-0720-v12-1003.pdf

http://www.abgene.com/productDetails.asp?prodID=9


PCR mix (50 µl total volume)

Mix A (25 µl)

Mix B (25 µl)

ddH2O

19.5 µl

ddH2O

16 µl

10x buffer (red cap)

5.0 µl

DNA (10 ng/µl)

6 µl

Polymerase

0.5 µl

LPCRfw (10 µM)

1 µl



LPCRrv (10 µM)

1 µl



dNTPs (10 mM)

1 µl

Mix A and B separately, then combine just before amplification.


PCR amplification primers

For amplification of the whole mitochondrial DNA molecule, four primer pairs are used: LPCRfw/rv (Long-PCR forward/reverse) 1, 3, 4 & 5. Subsequently, each fragment is purified and sequenced in its entirety using a primer-walking sequencing strategy (see primer list for more information below).

Long PCR primers (5' - 3')

Forward primers

  • LPCRfw1---AGACCCGCTCCCCTTTCCTG
  • LPCRfw3---ATTCTTTTAGCCTCGGGGGTCAC
  • LPCRfw4---CCCGCTTATCCCCACTCCAAAAAC
  • LPCRfw5---TAGGCCCCTTACGCAACTGAATG

Reverse primers

  • LPCRrv1---TAGTTGGGCCGGTGGTGATTC
  • LPCRrv3---AGCGGCTGCCATAGTTAGGAGGAG
  • LPCRrv4---TGCACATATCGCCCGTCACTCTC
  • LPCRrv5---CCGCCAAATGGAGGGAGAAG

Estimated product sizes for Long PCR primer combinations

Primer combination

Product size

LPCRfw1/rv1

5571 bp

LPCRfw3/rv3

5600 bp

LPCRfw4/rv4

4730 bp

LPCRfw5/rv5

4791 bp


Primer-walking strategy

The following sequencing primers are used to sequence each amplified product in its entirety. Primer starts and fragment ends refer to positions along the published Daphnia mitochondrial DNA sequence.

Primer-walk sequencing primers (5' - 3')

Fragment

Sequence ID

Primer sequence

Primer start

Fragment end

LPCR1

LPCR1

AGACCCGCTCCCCTTTCCTG

1106

1806

LPCR1

Seq1.1

TCTTCCTCCGGCACTTACAC

1706

2406

LPCR1

Seq1.2b

GCATGGATGTTGACACACG

2281

2981

LPCR1

Seq1.3

ACTGCGACCGACTTTGTTCT

2942

3642

LPCR1

Seq1.4

TCGACCAGGTGTCTTTTATGG

3564

4264

LPCR1

Seq1.5

AGGGGCACACACTCATTTTT

4185

4885

LPCR1

Seq1.6

GGCAATCCTAGGCATTTTGT

4778

5478

LPCR3

Seq3.1

TGGCACTTTGTTGACGTTGT

5377

6077

LPCR3

Seq3.2

AGTTTCGGCCTAAAAGACTGA

5945

6645

ND5 sequence primers (see below)

LPCR3

Seq3.3

GATAGCTACAACCCCCGACA

7168

7868

LPCR3

Seq3.4

CACAAAACCACAGCAAGAAAA

7755

8455

LPCR3

Seq3.5

AGTCCCCATACGCTCGTAGA

8368

9068

LPCR3

Seq3.6b

GAGGCAGCAAGGGTGTAAAA

8900

9600

LPCR4

Seq4.1

AGCCAGAAGATGCTTACGTTT

9543

10243

LPCR4

Seq4.2

CGAACAATTAGGCGGAATGA

10182

10882

LPCR4

Seq4.3

GGGGAGGCTTTGCTGTAGAT

10791

11491

LPCR4

Seq4.4

TAGTGGGCCAGCTTTTTACC

11342

12042

LPCR4

Seq4.5

CCCAACTCATACCCCACAGT

11937

12631

16S sequence primers (see below)

LPCR5

Seq5.1

ACAGGGGGAGATGTTTTTGA

13131

13831

LPCR5

Seq5.2

GGGATGGCTGATAATTTCTTT

13726

14426

LPCR5

Seq5.3

CAGGGTATCTAATCCTGGTTTTT

14318

15018

Control region sequence primers (see below)

LPCR5

Seq5.4

GATGCAACTTGTTGCTCAAA

42

742

LPCR5

Seq5.5

AGCAGGCCTAACTCAGACGA

671

1371

LPCR5

Seq5.6

GAGGGGATGCTCCCATTATT

1258

1831


Other mitochondrial PCR/sequencing primers (5' - 3')

Control Region

  • IAITfw---TAACCGCGACGGCTGGC
  • IAITrv1---GGGCATGAACCCACTAGC
  • IAITrv2---GAAAGAATGAGACTGAAGAC

Paland, S., J.K. Colbourne and M. Lynch. 2005. Evolutionary history of contagious asexuality in Daphnia pulex. Evolution 59:800-813.

ND5

  • DpuND5a---ATAAAACTCCAATCAACCTTG
  • DpuND5b---GGGGTGTATCTATTAATTCG

Colbourne, J.K., T.J. Crease, L.J. Weider, P.D.N. Hebert, A. Hobæk and F. Dufresne. 1998. Phylogenetics and evolution of a circumarctic species complex (Cladocera: Daphnia pulex). Biological Journal of the Linnean Society 65:347-365.

16S

  • 16Sar---CGCCTGTTTATCAAAAACAT
  • 16Sbr---CCGGTCTGAACTCAGATCAC/TGT

Taylor, D.J., T.L. Finston and P.D.N. Hebert. 1998. Biogeography of a widespread freshwater crustacean: pseudocongruence and cryptic endemism in the North American Daphnia laevis complex. Evolution 52:1648-1670.

COI

  • FOLa---GGTCAACAAATCATAAAGATATTCG
  • FOLb---TAAACTTCAGGGTGACCAAAAAATCA

Havel, J.E., J.K. Colbourne and P.D.N. Hebert. 2001. Reconstructing the history of intercontinental dispersal in Daphnia lumholtzi by use of genetic markers. Limnology and Oceanography 45:1414-1419.

  • No labels